PHYLIP: Эволюциялық ағаштарды құру бағдарламалар жинағы

PHYLogeny Inference Package (PHYLIP) is a free computational phylogenetics package of programs for inferring evolutionary trees (phylogenies). It consists of 65 portable programs, i. e., the source code is written in the programming language C. As of version 3.696, it is licensed as open source software; versions 3.695 and older were proprietary software freeware. Releases occur as source code, and as precompiled executables for many operating systems including Windows (95, 98, ME, NT, 2000, XP, Vista), Mac OS 8, Mac OS 9, OS X, Linux (Debian, Red Hat); and FreeBSD from FreeBSD. org. Full documentation is written for all the programs in the package and is included therein. The programs in the phylip package were written by Professor Joseph Felsenstein, of the Department of Genome Sciences and the Department of Biology, University of Washington, Seattle. Methods (implemented by each program) that are available in the package include parsimony, distance matrix, and likelihood methods, including bootstrapping and consensus trees. Data types that can be handled include molecular sequences, gene frequencies, restriction sites and fragments, distance matrices, and discrete characters. and IQ TREE programs, use the phylip format or a minor modification of that format called the relaxed phylip format. Relaxed phylip format (sequential):
5 42
Turkey AAGCTNGGGCATTTCAGGGTGAGCCCGGGCAATACAGGGTAT
Salmo schiefermuelleri AAGCCTTGGCAGTGCAGGGTGAGCCGTGGCCGGGCACGGTAT
H sapiens ACCGGTTGGCCGTTCAGGGTACAGGTTGGCCGTTCAGGGTAA
Chimp AAACCCTTGCCGTTACGCTTAAACCGAGGCCGGGACACTCAT
Gorilla AAACCCTTGCCGGTACGCTTAAACCATTGCCGGTACGCTTAA
The primary difference in relaxed phylip format is the absence of the 10 character limit and the removal of the need to blank fill names to reach that length (although filling names to start the character matrix at the same position can improve readability for user). This example of relaxed uses underscores rather than spaces in the names and uses spaces between the names and the aligned character data; it is often good practice to avoid white space within taxon names and to separate the character data from the name when generating files. Like strict phylip format files, relaxed phylip format files can be in interleaved format and include spaces and endlines within the sequence data. The programs that use distance data, like the neighbor program that implements the neighbor joining method, also use a simple distance matrix format the includes only the number of taxa, their names, and numerical values for the distances:

Phylip distance matrix:
7
Bovine 0.0000 1.6866 1.7198 1.6606 1.5243 1.6043 1.5905
Mouse 1.6866 0.0000 1.5232 1.4841 1.4465 1.4389 1.4629
Gibbon 1.7198 1.5232 0.0000 0.7115 0.5958 0.6179 0.5583
Orang 1.6606 1.4841 0.7115 0.0000 0.4631 0.5061 0.4710
Gorilla 1.5243 1.4465 0.5958 0.4631 0.0000 0.3484 0.3083
Chimp 1.6043 1.4389 0.6179 0.5061 0.3484 0.0000 0.2692
Human 1.5905 1.4629 0.5583 0.4710 0.3083 0.2692 0.0000
The number indicates the number of taxa and same limitations for taxon names exist. Note that this matrix is symmetric and the diagonal has values of 0 (since the distance between a taxon and itself is zero by definition). Programs that use trees as input accept the trees in Newick format, an informal standard agreed to in 1986 by authors of seven major phylogeny packages. Output is written onto files with names like outfile and outtree. Trees written onto outtree are in the Newick format.

+Programs listed in PHYLIP Program name Description protpars Estimates phylogenies of peptide sequences using the parsimony method dnapars Estimates phylogenies of DNA sequences using the parsimony method dnapenny DNA parsimony branch and bound method, finds all of the most parsimonious phylogenies for nucleic acid sequences by branch and bound search dnamove Interactive construction of phylogenies from nucleic acid sequences, with their evaluation by DNA parsimony method, with compatibility and display of reconstructed ancestral bases dnacomp Estimates phylogenies from nucleic acid sequence data using the compatibility criterion dnaml Estimates phylogenies from nucleotide sequences using the maximum likelihood method dnamlk DNA maximum likelihood method with molecular clock; using both dnaml and dnamlk together permits a likelihood ratio test for the molecular clock hypothesis proml Estimates phylogenies from protein amino acid sequences by using the maximum likelihood method promlk Protein sequence maximum likelihood method with molecular clock restml Estimation of phylogenies by maximum likelihood using restriction sites data; not from restriction fragments but from the presence or absence of individual sites dnainvar For nucleic acid sequence data on four species, computes Lake's and Cavender's phylogenetic invariants, which test alternative tree topologies dnadist DNA distance method which computes four different distances between species from nucleic acid sequences; distances can then be used in the distance matrix programs protdist Protein sequence distance method which computes a distance measure for sequences, using maximum likelihood estimates based on the Dayhoff PAM matrix, Kimura's 1983 approximation to it, or a model based on genetic code plus a constraint on changing to a different category of amino acid restdist Distances calculated from restriction sites data or restriction fragments data seqboot Bootstrapping jackknifing program; reads in a data set, and emits multiple data sets from it by bootstrap resampling fitch Fitch Margoliash distance matrix method; estimates phylogenies from distance matrix data under the additive tree model according to which the distances are expected to equal the sums of branch lengths between species kitsch Fitch Margoliash distance matrix method with molecular clock; estimates phylogenies from distance matrix data under the ultrametric model which is the same as the additive tree model except an evolutionary clock is assumed neighbor Implementation of the methods neighbor joining and UPGMA contml Maximum likelihood continuous characters and gene frequencies; estimates phylogenies from gene frequency data by maximum likelihood under a model in which all divergence is due to genetic drift in the absence of new mutations; also does maximum likelihood analysis of continuous characters that evolve by a Brownian Motion model, assuming that the characters evolve at equal rates and in an uncorrelated fashion; does not account for character correlations contrast Reads a tree from a tree file, and a data set with continuous characters data, and emits the independent contrasts for those characters, for use in any multivariate statistics package gendist Genetic distance program which computes one of three different genetic distance formulas from gene frequency data pars Unordered multistate discrete characters parsimony method mix Estimates phylogenies by some parsimony methods for discrete character data with two states (0, 1); allows using methods: Wagner, Camin Sokal, or arbitrary mixes penny Branch and bound mixed method which finds all of the most parsimonious phylogenies for discrete character data with two states, for the Wagner, Camin Sokal, and mixed parsimony criteria using the branch and bound method of exact search move Interactive construction of phylogenies from discrete character data with two states (0, 1); evaluates parsimony and compatibility criteria for those phylogenies and displays reconstructed states throughout the tree dollop Estimates phylogenies by the Dollo or polymorphism parsimony criteria for discrete character data with two states (0, 1) dolpenny Finds all or most parsimonious phylogenies for discrete character data with two states, for the Dollo or polymorphism parsimony criteria using the branch and bound method of exact search dolmove Interactive construction of phylogenies from discrete character data with two states (0, 1) using the Dollo or polymorphism parsimony criteria; evaluates parsimony and compatibility criteria for those phylogenies; displays reconstructed states throughout the tree clique Finds the largest clique of mutually compatible characters, and the phylogeny which they recommend, for discrete character data with two states (0, 1); the largest clique (or all cliques within a given size range of the largest one) are found by a fast branch and bound search method factor Character recoding program which takes discrete multistate data with character state trees and emits the corresponding data set with two states (0, 1) drawgram Rooted tree drawing program which plots rooted phylogenies, cladograms, and phenograms in a wide variety of user controllable formats. The program is interactive and allows previewing of the tree on PC or Macintosh graphics screens, and Tektronix or Digital graphics terminals. drawtree Unrooted tree drawing program similar to DRAWGRAM, but plots phylogenies consense Consensus tree program which computes trees by the majority rule tree method, which also allows easily finding the strict consensus tree; unable to compute Adams consensus tree treedist Computes the Robinson–Foulds symmetric difference distance between trees, which allows differences in tree topology retree Interactive tree rearrangement program which reads in a tree (with branch lengths if needed) and allows rerooting the tree, to flip branches, to change species names and branch lengths, and then write the result out; can be used to convert between rooted and unrooted trees